View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12241_low_31 (Length: 225)

Name: NF12241_low_31
Description: NF12241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12241_low_31
NF12241_low_31
[»] chr3 (1 HSPs)
chr3 (17-193)||(31266951-31267129)


Alignment Details
Target: chr3 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 17 - 193
Target Start/End: Original strand, 31266951 - 31267129
Alignment:
Q  17 agacagaaccatcaaccatcagtggtacgcataatccaaagaatccaaggtgccaaaaatttccttcatcgcagaagcatgaagagggtgcgttgagatc 116  Q
    |||||||||| |||||||||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||| |||||||||    
T  31266951 agacagaaccgtcaaccatcagtggtacgcataatccaaagaatccg-ggtgccaaaaatttccttcatcgcagaagcatgaagagggtgtgttgagatc 31267049  T
Q  117 tttaaaaacttcagt---gcatactctcattaatataattaatagaagtaaatcctttagtacgagtaaaattaagtact 193  Q
    |||||||||||||||   ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
T  31267050 tttaaaaacttcagtacagcatactctcattaatataattaatagaagtaaatcctttagtacgagtaaaactaagtact 31267129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University