View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12205_high_20 (Length: 233)

Name: NF12205_high_20
Description: NF12205
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12205_high_20
NF12205_high_20
[»] chr8 (1 HSPs)
chr8 (24-127)||(45124871-45124974)


Alignment Details
Target: chr8 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 24 - 127
Target Start/End: Complemental strand, 45124974 - 45124871
Alignment:
Q  24 tactaattaattcctctacttttaattatagctagagaatcagtttgagatattgtggtccatgtaatgccttggccaaacaataagttgttgtcatata 123  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  45124974 tactaattaattcctctacttttaattacagctagagaatcagtttgagatattgtggtccatgtaatgccttggccaaacaataagttgttgtcatata 45124875  T
Q  124 tata 127  Q
    ||||    
T  45124874 tata 45124871  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University