View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12189_high_14 (Length: 204)

Name: NF12189_high_14
Description: NF12189
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12189_high_14
NF12189_high_14
[»] chr4 (1 HSPs)
chr4 (78-186)||(54650963-54651071)


Alignment Details
Target: chr4 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 78 - 186
Target Start/End: Original strand, 54650963 - 54651071
Alignment:
Q  78 ttaattctttacagcaactaattttaatttatgttctacttttttggtgatagattatatctgcatgtctctctgaaaccttgtttggcatgtcccacac 177  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  54650963 ttaattctttacaacaactaattttaatttatgttctacttttttggtgatagattatatctgcatgtctctctgaaaccttgtttggcatgtcccacac 54651062  T
Q  178 cgttaaaac 186  Q
    |||||||||    
T  54651063 cgttaaaac 54651071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University