View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12174_low_27 (Length: 242)

Name: NF12174_low_27
Description: NF12174
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12174_low_27
NF12174_low_27
[»] chr2 (1 HSPs)
chr2 (12-233)||(43541063-43541284)


Alignment Details
Target: chr2 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 12 - 233
Target Start/End: Original strand, 43541063 - 43541284
Alignment:
Q  12 ctgtggtggttagctataagaagcagaagaaggattatgaagataggattaagattcagaaagctgatgcggaagagagaaggaagatgagggagatgga 111  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  43541063 ctgtggtggttagctataagaagcagaagaaggattacgaagataggattaagattcagaaagctgatgcggaagagagaaggaagatgagggagatgga 43541162  T
Q  112 agccgagatggggtggagtgaagctggcggtgatgaggatgagagtgagctggtgaaagaaggagaggagaatccttatttgaaaatgacaaaggagttt 211  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  43541163 agccgagatggggtggagtgaagctggcggtgatgaggatgagagtgagctggtgaaagaaggagaggagaatccttatttgaaaatgacaaaggagttt 43541262  T
Q  212 atgaaatctggggcacaggttc 233  Q
    |||||||||||||||| |||||    
T  43541263 atgaaatctggggcacgggttc 43541284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University