View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12170_high_7 (Length: 354)

Name: NF12170_high_7
Description: NF12170
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12170_high_7
NF12170_high_7
[»] chr8 (3 HSPs)
chr8 (13-133)||(41324886-41325006)
chr8 (190-348)||(41324671-41324829)
chr8 (291-329)||(42051604-42051641)
[»] chr7 (1 HSPs)
chr7 (287-333)||(33671552-33671598)
[»] chr2 (1 HSPs)
chr2 (289-333)||(28550475-28550519)
[»] chr1 (3 HSPs)
chr1 (288-326)||(23203355-23203393)
chr1 (291-333)||(29450974-29451016)
chr1 (291-323)||(7454571-7454603)
[»] chr3 (1 HSPs)
chr3 (289-326)||(9598472-9598509)


Alignment Details
Target: chr8 (Bit Score: 117; Significance: 1e-59; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 13 - 133
Target Start/End: Complemental strand, 41325006 - 41324886
Alignment:
Q  13 tgaattcaacgtaacgtcaaaatagtctaggttgctctagcaaacaaaccaaatccaccatcaaaataagtttagcagtactataaacttagcataatat 112  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
T  41325006 tgaattcaacgtaacgtcaaaatagtctaggttgctctagcaaacaaaccaaatccaccatcaaaataagtttagcagtactataaactcagcataatat 41324907  T
Q  113 gttcaacaaaacgagctacag 133  Q
    |||||||||||||||||||||    
T  41324906 gttcaacaaaacgagctacag 41324886  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 190 - 348
Target Start/End: Complemental strand, 41324829 - 41324671
Alignment:
Q  190 cctgataagccaacctaccctgcccttcattgctccaatatttccgtgggttaaacgaggctgacaaacatgtgtgattaccccatcnnnnnnnncatgt 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||        |||||    
T  41324829 cctgataagccaacctaccctgcccttcattgctccaatatttccgtgggttaaacgaggctgacaaacatgtgtgattaccccatcttttttttcatgt 41324730  T
Q  290 agtggtcggggtttgaatcacgaaccttgcatatttttatgcataccaactgagctaag 348  Q
     |||| | ||||||||| ||||||||||||||||||||||||||||||||||| |||||    
T  41324729 ggtggccagggtttgaaccacgaaccttgcatatttttatgcataccaactgaactaag 41324671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 291 - 329
Target Start/End: Complemental strand, 42051641 - 42051604
Alignment:
Q  291 gtggtcggggtttgaatcacgaaccttgcatatttttat 329  Q
    |||||||||||||||||| ||||||||||||||||||||    
T  42051641 gtggtcggggtttgaatc-cgaaccttgcatatttttat 42051604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 287 - 333
Target Start/End: Original strand, 33671552 - 33671598
Alignment:
Q  287 tgtagtggtcggggtttgaatcacgaaccttgcatatttttatgcat 333  Q
    |||||||||||||||||||| | ||||||||||||||||||||||||    
T  33671552 tgtagtggtcggggtttgaacctcgaaccttgcatatttttatgcat 33671598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 289 - 333
Target Start/End: Original strand, 28550475 - 28550519
Alignment:
Q  289 tagtggtcggggtttgaatcacgaaccttgcatatttttatgcat 333  Q
    ||||||| |||||||||||| || |||||||||||||||||||||    
T  28550475 tagtggttggggtttgaatcccggaccttgcatatttttatgcat 28550519  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 31; Significance: 0.00000003; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 288 - 326
Target Start/End: Complemental strand, 23203393 - 23203355
Alignment:
Q  288 gtagtggtcggggtttgaatcacgaaccttgcatatttt 326  Q
    ||||||||||||||||||| | |||||||||||||||||    
T  23203393 gtagtggtcggggtttgaaccccgaaccttgcatatttt 23203355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 291 - 333
Target Start/End: Original strand, 29450974 - 29451016
Alignment:
Q  291 gtggtcggggtttgaatcacgaaccttgcatatttttatgcat 333  Q
    |||||||||| ||||||| ||||||||||||||| ||||||||    
T  29450974 gtggtcgggggttgaatcccgaaccttgcatattattatgcat 29451016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 291 - 323
Target Start/End: Original strand, 7454571 - 7454603
Alignment:
Q  291 gtggtcggggtttgaatcacgaaccttgcatat 323  Q
    ||||||||||||||||||| |||||||||||||    
T  7454571 gtggtcggggtttgaatcatgaaccttgcatat 7454603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 289 - 326
Target Start/End: Complemental strand, 9598509 - 9598472
Alignment:
Q  289 tagtggtcggggtttgaatcacgaaccttgcatatttt 326  Q
    |||||||||||||||||||| || ||||||||||||||    
T  9598509 tagtggtcggggtttgaatctcggaccttgcatatttt 9598472  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University