View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12163_low_5 (Length: 297)

Name: NF12163_low_5
Description: NF12163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12163_low_5
NF12163_low_5
[»] chr7 (1 HSPs)
chr7 (17-194)||(33791362-33791539)


Alignment Details
Target: chr7 (Bit Score: 166; Significance: 7e-89; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 166; E-Value: 7e-89
Query Start/End: Original strand, 17 - 194
Target Start/End: Original strand, 33791362 - 33791539
Alignment:
Q  17 aaaacgttggttcaatggtgtggtgttgaaggtaaggatccattggtgtttttggatcaaaacacttcttttgtgtttgatcatcaattttataatcaga 116  Q
    |||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
T  33791362 aaaaggttggttcaatggtgtggtgttgaaggtaaggatccattagtgtttttggatcaaaacacttcttttgtttttgatcatcaattttataatcaga 33791461  T
Q  117 ttttgttggggagaggtgtgttaacaattgaccagaatttggctctagattccatttccaaaggggttgtcacaggtt 194  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  33791462 ttttgttggggagaggtgtgttaacaattgaccagaatttggctctagattccatttccaaaggggttgtcacaggtt 33791539  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University