View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12158_high_3 (Length: 343)

Name: NF12158_high_3
Description: NF12158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12158_high_3
NF12158_high_3
[»] chr7 (1 HSPs)
chr7 (224-330)||(3225753-3225860)


Alignment Details
Target: chr7 (Bit Score: 71; Significance: 4e-32; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 224 - 330
Target Start/End: Original strand, 3225753 - 3225860
Alignment:
Q  224 gaattattgttgcaatttaatcgtatagagtttttgtttcttcaacnnnnnnn-tacaaagttattgttatgacctgtttaatcattttttagggtgttg 322  Q
    |||||||||||||||||||||| |||||||||||||||||||||||        |||| |||||||||||||||||||||||||||||||||||||||||    
T  3225753 gaattattgttgcaatttaatcatatagagtttttgtttcttcaacaaaaaaaatacagagttattgttatgacctgtttaatcattttttagggtgttg 3225852  T
Q  323 ggttatat 330  Q
    ||||||||    
T  3225853 ggttatat 3225860  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University