View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12150_low_5 (Length: 205)

Name: NF12150_low_5
Description: NF12150
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12150_low_5
NF12150_low_5
[»] chr4 (1 HSPs)
chr4 (10-188)||(41630015-41630193)


Alignment Details
Target: chr4 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 10 - 188
Target Start/End: Original strand, 41630015 - 41630193
Alignment:
Q  10 agaacctgtgagttcagtttctgatacttcacctgaagaagatgttgctatgtgtctcatgatgctttcgagggacaaatggagtcgaaagatgaacaac 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  41630015 agaacctgtgagttcagtttctgatacttcacctgaagaagatgttgctatgtgtctcatgatgctttcgagggacaaatggagtcgaaagatgaacaac 41630114  T
Q  110 gacaacaatgtggaacaagaagaagatgagggatcggtggagaaaatatcgaaggtgaagttattgaaacgagttcgtg 188  Q
    | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  41630115 gtcaacaatgtggaacaagaagaagatgagggatcggtggagaaaatatcgaaggtgaagttattgaaacgagttcgtg 41630193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University