View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12142_low_10 (Length: 441)

Name: NF12142_low_10
Description: NF12142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12142_low_10
NF12142_low_10
[»] chr4 (3 HSPs)
chr4 (214-428)||(41011602-41011812)
chr4 (114-168)||(41011858-41011912)
chr4 (65-116)||(41011974-41012025)


Alignment Details
Target: chr4 (Bit Score: 174; Significance: 2e-93; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 174; E-Value: 2e-93
Query Start/End: Original strand, 214 - 428
Target Start/End: Complemental strand, 41011812 - 41011602
Alignment:
Q  214 gttgcggaattatctgcacataaataagactgggtgaaaatatatatgtccacttattttagtgaaccatccattccgctttgtttagggtggattggtg 313  Q
    ||||||||||||||||||||||||||||| |||||||||||||    ||||||||||||||||| |||||||||||||||||||||||||||||||||||    
T  41011812 gttgcggaattatctgcacataaataagattgggtgaaaatat----gtccacttattttagtggaccatccattccgctttgtttagggtggattggtg 41011717  T
Q  314 gcaacgcttcttaattcacttccgatctcttatcttattaagaaatgacatccatgattcaaatacataaattcaaattagatcatgtcccttagtcttt 413  Q
    || ||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  41011716 gcgacgtttcttaattcacttctgatctcttatcttattaagaaatgacatccatgattcaaatacataaattcaaattagatcatgtcccttagtcttt 41011617  T
Q  414 cttggatgcccttct 428  Q
    || ||||||||||||    
T  41011616 ctcggatgcccttct 41011602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 114 - 168
Target Start/End: Complemental strand, 41011912 - 41011858
Alignment:
Q  114 tggaggctttagtggccaaccgtcatttttggcgggcaacccgttaatcggctgc 168  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
T  41011912 tggaggctttagtggccaaccgtcatttttggcgggcaacccgttaatcagctgc 41011858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 65 - 116
Target Start/End: Complemental strand, 41012025 - 41011974
Alignment:
Q  65 taactttctctccaaaatggtcaacttgtttaggcatattaaagcgagttgg 116  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||    
T  41012025 taactttttctccaaaatggtcaacttgtttaggcatattaaagcgagttgg 41011974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University