View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1213_low_99 (Length: 249)

Name: NF1213_low_99
Description: NF1213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1213_low_99
NF1213_low_99
[»] chr5 (3 HSPs)
chr5 (91-202)||(22627531-22627642)
chr5 (32-88)||(22627714-22627770)
chr5 (201-241)||(22627469-22627509)


Alignment Details
Target: chr5 (Bit Score: 80; Significance: 1e-37; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 91 - 202
Target Start/End: Complemental strand, 22627642 - 22627531
Alignment:
Q  91 aagtatgttggtggctaaaaattcacctttctcaaggtgaataagccgtagagtgttctgcataaattatgtattgtttctaatcctaccaagacaaggt 190  Q
    |||||||||||||||||||||||||||||| ||||||| ||||||| |||||||||| ||||||||||||  |||||||||||||||||| ||||| |||    
T  22627642 aagtatgttggtggctaaaaattcacctttttcaaggtaaataagctgtagagtgttatgcataaattataaattgtttctaatcctaccgagacatggt 22627543  T
Q  191 aaattttcttgg 202  Q
    ||||||||||||    
T  22627542 aaattttcttgg 22627531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 32 - 88
Target Start/End: Complemental strand, 22627770 - 22627714
Alignment:
Q  32 cgaatgtgctacacccatttctagaatacttcaaaaaatgttgtttttcaaatttta 88  Q
    ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
T  22627770 cgaatgtgctacacccatttctagaatacttgaaaaaatgttgtttttcaaatttta 22627714  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 201 - 241
Target Start/End: Complemental strand, 22627509 - 22627469
Alignment:
Q  201 ggtgtaacaatatttaatctaaactgaatcatatgtagtgt 241  Q
    |||||||||||||||||||||||||||||||||||| ||||    
T  22627509 ggtgtaacaatatttaatctaaactgaatcatatgtggtgt 22627469  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University