View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1213_low_77 (Length: 286)

Name: NF1213_low_77
Description: NF1213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1213_low_77
NF1213_low_77
[»] chr3 (1 HSPs)
chr3 (65-269)||(40345486-40345690)


Alignment Details
Target: chr3 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 65 - 269
Target Start/End: Original strand, 40345486 - 40345690
Alignment:
Q  65 attatttaaggacctgtaaatacttgctgaaagaaatttaatctctttgttgcagcaatcgagatctttccatgatccttgacgctcttctcaaaacaaa 164  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  40345486 attatttaaggacctgtaaatacttgctgaaagaaatttaatctctttgttgcagcaatcgagatctttccatgatccttgacgctcttctcaaaacaaa 40345585  T
Q  165 atctagagctgtgctgaatgatataattagtaaaaatggtaatctatacttgctttgaatttaatgaaaattttctcctatttatcaggaacgttagacc 264  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||    
T  40345586 atctagagctgtgctgaatgatataattagtaaaaatggtaatctatacttgctttgcatttaatgaaaattttctcccatttatcaggaacgttagacc 40345685  T
Q  265 tatga 269  Q
     ||||    
T  40345686 catga 40345690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University