View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1213_high_68 (Length: 285)

Name: NF1213_high_68
Description: NF1213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1213_high_68
NF1213_high_68
[»] chr5 (3 HSPs)
chr5 (1-38)||(41531764-41531801)
chr5 (107-142)||(41531870-41531905)
chr5 (241-285)||(41531751-41531795)


Alignment Details
Target: chr5 (Bit Score: 38; Significance: 0.000000000002; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 1 - 38
Target Start/End: Original strand, 41531764 - 41531801
Alignment:
Q  1 aaagtgtctttttacaatttaatttgttgttattttcc 38  Q
    ||||||||||||||||||||||||||||||||||||||    
T  41531764 aaagtgtctttttacaatttaatttgttgttattttcc 41531801  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 107 - 142
Target Start/End: Original strand, 41531870 - 41531905
Alignment:
Q  107 tctttaacattgatgtttgatatccagtatgatgat 142  Q
    ||||||||||||||||||||||||||||||||||||    
T  41531870 tctttaacattgatgtttgatatccagtatgatgat 41531905  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 241 - 285
Target Start/End: Original strand, 41531751 - 41531795
Alignment:
Q  241 ttgttataaatttaaagtgtccttttacaatttaatttgttgtta 285  Q
    |||||||  |||||||||||| |||||||||||||||||||||||    
T  41531751 ttgttatttatttaaagtgtctttttacaatttaatttgttgtta 41531795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University