View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12139_low_10 (Length: 214)

Name: NF12139_low_10
Description: NF12139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12139_low_10
NF12139_low_10
[»] chr1 (1 HSPs)
chr1 (21-161)||(45850195-45850335)


Alignment Details
Target: chr1 (Bit Score: 120; Significance: 1e-61; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 21 - 161
Target Start/End: Complemental strand, 45850335 - 45850195
Alignment:
Q  21 gttacattaacacatctgcctcatcatgtgtgaagttacgagtacgagagacaagagagaaataaggatgttacattaaaaactgaagtattaannnnnn 120  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||          
T  45850335 gttacattaacacatctgcctcatcatgtgtgaagttacgagtacgagagacaagagagaaataaggatgttacattaaaaactgaagtattaatttttt 45850236  T
Q  121 naataaacaatctttcaatatagaatccttaaagagtgtct 161  Q
     ||||||||||||||||||||||||||||||||||||||||    
T  45850235 taataaacaatctttcaatatagaatccttaaagagtgtct 45850195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University