View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12136_low_5 (Length: 301)

Name: NF12136_low_5
Description: NF12136
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12136_low_5
NF12136_low_5
[»] chr6 (2 HSPs)
chr6 (111-284)||(7426831-7427004)
chr6 (15-61)||(7426735-7426781)


Alignment Details
Target: chr6 (Bit Score: 149; Significance: 1e-78; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 111 - 284
Target Start/End: Original strand, 7426831 - 7427004
Alignment:
Q  111 catgagagaattggcctaaatctcaaaagagaatattggcnnnnnnnattttcccaattgatctagtgaatggtgatttcctgcttgatgagtggatgac 210  Q
    ||||||||||||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  7426831 catgagagaattggcctaaatctcaaaagagaatattggctttttttattttcccaattgatctagtgaatggtgatttcctgcttgatgagtggatgac 7426930  T
Q  211 ttctctttaacaatactcatattcatacatgcagtttaaaaaacaatatttgtacttttattcattggatatct 284  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  7426931 ttctctttaacaatactcgtattcatacatgcagtttaaaaaacaatatttgtacttttattcattggatatct 7427004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 15 - 61
Target Start/End: Original strand, 7426735 - 7426781
Alignment:
Q  15 cagagagtatgaaaaagagttgtcacaaaataacggtacaaatatca 61  Q
    ||||||||||||||||||||||||||||||||||||||||| |||||    
T  7426735 cagagagtatgaaaaagagttgtcacaaaataacggtacaactatca 7426781  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University