View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12132_low_3 (Length: 236)

Name: NF12132_low_3
Description: NF12132
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12132_low_3
NF12132_low_3
[»] chr2 (2 HSPs)
chr2 (22-183)||(40998782-40998943)
chr2 (177-218)||(40998729-40998770)


Alignment Details
Target: chr2 (Bit Score: 158; Significance: 3e-84; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 22 - 183
Target Start/End: Complemental strand, 40998943 - 40998782
Alignment:
Q  22 aggcttttggttgattgaaattgtgggattattatggcattgaatatttctatgtgcagtggtcaatttcatcttaattatcttaaggatagcttagtta 121  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
T  40998943 aggcttttggttgattgaaattgtgggattattatggcattgaatatttgtatgtgcagtggtcaatttcatcttaattatcttaaggatagcttagtta 40998844  T
Q  122 agattaagttagccaatcataaaacacaattgtggaatatcgagtcaaaaagaatcttggct 183  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  40998843 agattaagttagccaatcataaaacacaattgtggaatatcgagtcaaaaagaatcttggct 40998782  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 177 - 218
Target Start/End: Complemental strand, 40998770 - 40998729
Alignment:
Q  177 cttggctcacaactcaaaactacaaacacatcttggctgcat 218  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  40998770 cttggctcacaactcaaaactacaaacacatcttggctgcat 40998729  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University