View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12129_high_8 (Length: 232)

Name: NF12129_high_8
Description: NF12129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12129_high_8
NF12129_high_8
[»] chr2 (1 HSPs)
chr2 (18-222)||(13589860-13590064)
[»] chr7 (1 HSPs)
chr7 (127-177)||(6724022-6724072)


Alignment Details
Target: chr2 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 18 - 222
Target Start/End: Complemental strand, 13590064 - 13589860
Alignment:
Q  18 tttacaagattaatctagtgattttttggggtatagtcattacggaactttctatgaggataaatagggcaagatatgaagaaaagcaaaaggtccaaca 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||  ||  ||||||||||||||||||||||    
T  13590064 tttacaagattaatctagtgattttttggggtatagtcattacggaactttcgatgaggataaatagggcaaagtactaagaaaagcaaaaggtccaaca 13589965  T
Q  118 tgcgtagtgctatgagttgcatgtcgcgcatctaagaaggattcaaaagtggtcagctaccggtagatttttgatgtgtgcattaagttgtatgttgcac 217  Q
    ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||    
T  13589964 tgcatagtgctatgagttgcatgtcgcgcatctaagaaggattcaaaagtggtcagctaccggtagatttgtgatgtgtgcagtaagttgtatgttgcac 13589865  T
Q  218 aggtt 222  Q
    |||||    
T  13589864 aggtt 13589860  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 127 - 177
Target Start/End: Original strand, 6724022 - 6724072
Alignment:
Q  127 ctatgagttgcatgtcgcgcatctaagaaggattcaaaagtggtcagctac 177  Q
    ||||||||||||||||  | | |||||||| ||||||||||||||||||||    
T  6724022 ctatgagttgcatgtcatgtagctaagaagaattcaaaagtggtcagctac 6724072  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University