View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12125_low_57 (Length: 230)

Name: NF12125_low_57
Description: NF12125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12125_low_57
NF12125_low_57
[»] chr2 (1 HSPs)
chr2 (12-214)||(41209876-41210078)


Alignment Details
Target: chr2 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 12 - 214
Target Start/End: Complemental strand, 41210078 - 41209876
Alignment:
Q  12 agcagcagagattgaaagccctggcaagctttagtaaacatggttgatgatctatatcacaaggaaaacccattttaaaactattcagaggatgactaga 111  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
T  41210078 agcagcagaaattgaaagccctggcaagctttagtaaacatggttgatgatctatatcacaaggaaaacccattttaaaactattcagaggatgaataga 41209979  T
Q  112 tgtagtttatctaagagcagcggacgaaaaacacataaatatagcccagtccaagtaaaatctgtaagcaattatcaagttggtatagataaacagaagt 211  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
T  41209978 tgtagtttatctaagagcagcggacgaaaaacacataaatatagcccagtccaagtaaaatctgtaagcaattatcaagttggtatagataaatagaagt 41209879  T
Q  212 atg 214  Q
    |||    
T  41209878 atg 41209876  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University