View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12125_low_47 (Length: 258)

Name: NF12125_low_47
Description: NF12125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12125_low_47
NF12125_low_47
[»] chr4 (2 HSPs)
chr4 (121-242)||(29461670-29461791)
chr4 (1-46)||(29461866-29461911)


Alignment Details
Target: chr4 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 121 - 242
Target Start/End: Complemental strand, 29461791 - 29461670
Alignment:
Q  121 cagtctcagaaagaaagctcaaaagggaaatatccaattttggtacatttaattatacataatcctaattgaataaaagaatttgtgtaccaccatagtg 220  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  29461791 cagtctcagaaagaaagctcaaaagggaaatatccaattttggtacatttaattatacataatcctaattgaataaaagaatttgtgtaccaccatagtg 29461692  T
Q  221 agaaaccatcaaaccaataaaa 242  Q
    ||||||||||||||||||||||    
T  29461691 agaaaccatcaaaccaataaaa 29461670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 29461911 - 29461866
Alignment:
Q  1 attaaaacaagggcccttaggttagtgtcaccagaattgagttgaa 46  Q
    ||||||||||||||||||||||||||||||||||||||||||||||    
T  29461911 attaaaacaagggcccttaggttagtgtcaccagaattgagttgaa 29461866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University