View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12125_low_31 (Length: 345)

Name: NF12125_low_31
Description: NF12125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12125_low_31
NF12125_low_31
[»] chr6 (2 HSPs)
chr6 (19-81)||(11601870-11601932)
chr6 (85-114)||(6382405-6382434)
[»] chr7 (1 HSPs)
chr7 (40-117)||(27720418-27720495)
[»] chr2 (1 HSPs)
chr2 (80-116)||(18569501-18569537)


Alignment Details
Target: chr6 (Bit Score: 59; Significance: 6e-25; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 19 - 81
Target Start/End: Complemental strand, 11601932 - 11601870
Alignment:
Q  19 gttctgggatacacaatgtagtataaagtgtcgtcaaatagtggctttagctgcgttatatca 81  Q
    ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
T  11601932 gttctgggatacacaatgtagtataaagtgttgtcaaatagtggctttagctgcgttatatca 11601870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 85 - 114
Target Start/End: Original strand, 6382405 - 6382434
Alignment:
Q  85 tagtgtagcagaatttggacaaatcgctat 114  Q
    ||||||||||||||||||||||||||||||    
T  6382405 tagtgtagcagaatttggacaaatcgctat 6382434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 40 - 117
Target Start/End: Original strand, 27720418 - 27720495
Alignment:
Q  40 tataaagtgtcgtcaaatagtggctttagctgcgttatatcactgtagtgtagcagaatttggacaaatcgctatttt 117  Q
    |||||||||||||||||| ||||||  ||| |  ||||| |||||||  ||||||||||||| ||||| | |||||||    
T  27720418 tataaagtgtcgtcaaatggtggctacagcagtcttatagcactgtaaagtagcagaatttgaacaaaccactatttt 27720495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 80 - 116
Target Start/End: Original strand, 18569501 - 18569537
Alignment:
Q  80 cactgtagtgtagcagaatttggacaaatcgctattt 116  Q
    |||||||||||||||||||||| ||||| ||||||||    
T  18569501 cactgtagtgtagcagaatttgaacaaaccgctattt 18569537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University