View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12125_high_49 (Length: 256)

Name: NF12125_high_49
Description: NF12125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12125_high_49
NF12125_high_49
[»] chr6 (1 HSPs)
chr6 (1-246)||(34340443-34340688)


Alignment Details
Target: chr6 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 1 - 246
Target Start/End: Original strand, 34340443 - 34340688
Alignment:
Q  1 ttcgctcacacgccggaacagctccgtcttaacgttcagcagagtccatcttcctcacggaatgttaattcgcctgattcgtatgacggttctccgttac 100  Q
    ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
T  34340443 ttcgctcacacgccggaacagcttcgtcttaacgttcagcagagtccatcttcctcacggagtgttaattcgcctgattcgtatgacggttctccgttac 34340542  T
Q  101 gacaaatggttactataacgaccccgccagaatctccaccgatgtcaccgatggcgagcgagatggtggcgtcgttacggaatttacaattgggtcggat 200  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  34340543 gacaaatggttactataacgacgccgccagaatctccaccgatgtcaccgatggcgagcgagatggtggcgtcgttacggaatttacaattgggtcggat 34340642  T
Q  201 gaaaactatgccaattaacagaaatgttacaattgggtcacaggtt 246  Q
    |||||||||||||||||| |||||||||||||||||||||| ||||    
T  34340643 gaaaactatgccaattaatagaaatgttacaattgggtcaccggtt 34340688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University