View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12123_low_7 (Length: 217)

Name: NF12123_low_7
Description: NF12123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12123_low_7
NF12123_low_7
[»] chr6 (2 HSPs)
chr6 (120-211)||(30866317-30866408)
chr6 (1-55)||(30866473-30866527)


Alignment Details
Target: chr6 (Bit Score: 84; Significance: 4e-40; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 84; E-Value: 4e-40
Query Start/End: Original strand, 120 - 211
Target Start/End: Complemental strand, 30866408 - 30866317
Alignment:
Q  120 gaattggagggtacaatacaataagctttattcactgtttttgttctgtttctcagtttgtaagcgttgttggaataattttttcacaggtt 211  Q
    |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||    
T  30866408 gaattggagggtacaatacaataagctttattcactgtttttattctgtttctcagtttgtaagcgttgttggaataattttttcataggtt 30866317  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 55
Target Start/End: Complemental strand, 30866527 - 30866473
Alignment:
Q  1 tttttggagtctacaacacctttggttccagctctgtatttctctaaggttgatc 55  Q
    |||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
T  30866527 tttttggagtctacaacacctttggttccagctcagtatttctctaaggttgatc 30866473  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University