View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12121_high_15 (Length: 206)

Name: NF12121_high_15
Description: NF12121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12121_high_15
NF12121_high_15
[»] chr2 (1 HSPs)
chr2 (22-172)||(2367673-2367823)


Alignment Details
Target: chr2 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 22 - 172
Target Start/End: Complemental strand, 2367823 - 2367673
Alignment:
Q  22 tggtggtattaagtaaataaattgttgaatggtggatttgtttaattgcttagtaattgttgtgtttactttgatagatcaattgattgttcagttgtta 121  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
T  2367823 tggtggtattaagtaaataaattgttgaatggtggatttgtttaattgcttagtagttgttgtgtttactttgatagatcaattgattgttcagttgtta 2367724  T
Q  122 ggtgatagtgttgtgttaagtgttaattgttaactaattttgatatatagc 172  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||    
T  2367723 ggtgatagtgttgtgttaagtgttaattgttaactaattttgatatatagc 2367673  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University