View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12077_low_33 (Length: 219)

Name: NF12077_low_33
Description: NF12077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12077_low_33
NF12077_low_33
[»] chr4 (1 HSPs)
chr4 (86-199)||(30371234-30371347)


Alignment Details
Target: chr4 (Bit Score: 114; Significance: 5e-58; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 114; E-Value: 5e-58
Query Start/End: Original strand, 86 - 199
Target Start/End: Complemental strand, 30371347 - 30371234
Alignment:
Q  86 ctatatataggtaaatttagagtatcaacttcaatgtgaaaacaacctatttcactttattaattatcattttctcttcacttaggatcttggtagatga 185  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  30371347 ctatatataggtaaatttagagtatcaacttcaatgtgaaaacaacctatttcactttattaattatcattttctcttcacttaggatcttggtagatga 30371248  T
Q  186 aactcataacacta 199  Q
    ||||||||||||||    
T  30371247 aactcataacacta 30371234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University