View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12055_high_57 (Length: 257)

Name: NF12055_high_57
Description: NF12055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12055_high_57
NF12055_high_57
[»] chr7 (1 HSPs)
chr7 (18-227)||(41325142-41325351)


Alignment Details
Target: chr7 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 18 - 227
Target Start/End: Original strand, 41325142 - 41325351
Alignment:
Q  18 cagttcaggctgctgatccacaggtttagccattgtgtatgtgccatgctgatcaatatttgaatctacaatattaatggtttcttgctccttcaactca 117  Q
    |||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
T  41325142 cagttcaggctgctgatccacaggcttagccattgtgtatgtgccatgctgatcaacatttgaatctacaatattaatggtttcttgctccttcaactca 41325241  T
Q  118 tctttagcatcttcatgatccaattgtaatttgaggccttcttccattctcttagcttcatccatgaatagaatagtgatgaatgatattcaacaatttt 217  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||    
T  41325242 tctttagcatcttcatgatccaattgtaatttgaggccttcttccattctcttagcttcatccatgaatagaatagtgatgaatgatattcaacaaattt 41325341  T
Q  218 ttcaaacgta 227  Q
    ||||||||||    
T  41325342 ttcaaacgta 41325351  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University