View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12051_high_27 (Length: 242)

Name: NF12051_high_27
Description: NF12051
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12051_high_27
NF12051_high_27
[»] chr2 (1 HSPs)
chr2 (1-223)||(43322393-43322618)


Alignment Details
Target: chr2 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 43322618 - 43322393
Alignment:
Q  1 ttgcttctgacaaaacacatgatgagatgttaaacaaaacacatgatatacaataaaactagtgaagaaaacagagtaagggacagaccaaacgagaata 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  43322618 ttgcttctgacaaaacacatgatgagatgttaaacaaaacacatgatatacaataaaactagtgaagaaaacagagtaagggacagaccaaacgagaata 43322519  T
Q  101 tttggtggtagtttacggtcttagtgtaccgttgtcggcaaaaccaaccccacgcacgggcaaatgccttgacgatcaaaagtggttaattcccaat--c 198  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||  |    
T  43322518 tttggtggtagtttacggtcttagtgtaccgttgtcggcaaaaccaaccccacgcacgggcaaatgccttgacgatcaaaagtggttaattcctaatggc 43322419  T
Q  199 accgg-aggctgaaatgggaccacta 223  Q
    ||||| ||||||||||||||||||||    
T  43322418 accggaaggctgaaatgggaccacta 43322393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University