View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1204_high_81 (Length: 260)

Name: NF1204_high_81
Description: NF1204
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1204_high_81
NF1204_high_81
[»] chr3 (1 HSPs)
chr3 (45-231)||(55180551-55180737)


Alignment Details
Target: chr3 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 45 - 231
Target Start/End: Complemental strand, 55180737 - 55180551
Alignment:
Q  45 tgaaatgatatatgtttgtttctacatgcnnnnnnncttttcttaaaaataatatatttgtgatagaatgtatttttggagtaacggataaggtaaaatt 144  Q
    |||||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
T  55180737 tgaaatgatatatgtttgtttctacatgctttttttcttttcttaaaaataatatatttgtgatagaatgtatttttggagtaacggacaaggtaaaatt 55180638  T
Q  145 caaactagtacaatagaatatatggtacctaacgtgatagtaatttgatacgatacaacataatattagttgttcccatctcgacca 231  Q
    ||||||||||||| | ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
T  55180637 caaactagtacaacaaaatatatggtacctaacgtgatagtaacttgatacgatacaacataatattagttgttcccatctcgacca 55180551  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University