View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12045_low_22 (Length: 241)

Name: NF12045_low_22
Description: NF12045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12045_low_22
NF12045_low_22
[»] chr6 (1 HSPs)
chr6 (1-220)||(24727018-24727232)


Alignment Details
Target: chr6 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 24727018 - 24727232
Alignment:
Q  1 aaaaaacaatgaaacgtcctctctcttcctccatcctctgccttccttatttctccaagtccccactccgtcgttccctctcctccaccaccaccatccc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  24727018 aaaaaacaatgaaacgtcctctctcttcctccatcctctgccttccttatttctccaagtccccactccgtcgttccctctcctccaccaccaccatccc 24727117  T
Q  101 tcttctgtctccggtgacggcggcggtgactaccaaaaa-ccccctttgtctcacccgcaaccaccattggccgctgccatggcctccctcactctccct 199  Q
    |||||||||||||||||||||||      |||||||||| |||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||    
T  24727118 tcttctgtctccggtgacggcgg------ctaccaaaaacccccctttgtctcacccgcaaccaccattggctgctgccatggcctctctcactctccct 24727211  T
Q  200 catcaaacatccttgtcatct 220  Q
    | ||||||||||||| |||||    
T  24727212 cgtcaaacatccttgacatct 24727232  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University