View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12033_low_26 (Length: 251)

Name: NF12033_low_26
Description: NF12033
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12033_low_26
NF12033_low_26
[»] chr8 (2 HSPs)
chr8 (1-102)||(30667579-30667680)
chr8 (166-232)||(30667449-30667515)


Alignment Details
Target: chr8 (Bit Score: 94; Significance: 5e-46; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 1 - 102
Target Start/End: Complemental strand, 30667680 - 30667579
Alignment:
Q  1 aacttaatgttaagagagaattgtggtatgcagagaaatggacggatcaattgtaaagcataattctcaacttatagtagatagactagaaggtagtaca 100  Q
    ||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  30667680 aacttaatgttaagagagaattgcggtatgcagagaaatggacgaatcaattgtaaagcataattctcaacttatagtagatagactagaaggtagtaca 30667581  T
Q  101 at 102  Q
    ||    
T  30667580 at 30667579  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 166 - 232
Target Start/End: Complemental strand, 30667515 - 30667449
Alignment:
Q  166 ggaattccgagaaaatcagaggggaagagaaattagaacattacaccaattccatgaccactttacc 232  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
T  30667515 ggaattccgagaaaatcagaggggaagagaaattagaacattacaccaattccatgacaactttacc 30667449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University