View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12031_low_9 (Length: 295)

Name: NF12031_low_9
Description: NF12031
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12031_low_9
NF12031_low_9
[»] chr1 (2 HSPs)
chr1 (25-153)||(255942-256070)
chr1 (25-155)||(228418-228550)


Alignment Details
Target: chr1 (Bit Score: 109; Significance: 7e-55; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 109; E-Value: 7e-55
Query Start/End: Original strand, 25 - 153
Target Start/End: Original strand, 255942 - 256070
Alignment:
Q  25 aaagaaagaaggaggctgatacagcagtagttgcaaatgacggtgctcttgtagatgatgatggcaaacccaaacgaacaggtctatagctctttttctt 124  Q
    |||| ||||||||||  |||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
T  255942 aaaggaagaaggaggtggatatagcagtagttgcaaatgacggtgctcttttagatgatgatggcaaacccaaacgaacaggtctatagctctttttctt 256041  T
Q  125 tctcaaaattttctgcatggtgaattata 153  Q
    |||||||||||||||||||||||||||||    
T  256042 tctcaaaattttctgcatggtgaattata 256070  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 25 - 155
Target Start/End: Complemental strand, 228550 - 228418
Alignment:
Q  25 aaagaaagaaggaggctgatacagcagtagttgcaaatgacggtgctcttgtagatgatgatggcaaacccaaacgaacaggtct--atagctctttttc 122  Q
    |||| ||||||||||  |||| ||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||| |  ||| |||||||||    
T  228550 aaaggaagaaggaggtggatatagcagtagttgcaaatgacggtgctcttgtagatgatgatggcaagcccatacgaacaggtatacataactctttttc 228451  T
Q  123 tttctcaaaattttctgcatggtgaattataat 155  Q
    |||| ||||||||| ||| ||||||| ||||||    
T  228450 tttcgcaaaattttatgcttggtgaaatataat 228418  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University