View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12023_low_97 (Length: 239)

Name: NF12023_low_97
Description: NF12023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12023_low_97
NF12023_low_97
[»] chr3 (1 HSPs)
chr3 (1-205)||(41469002-41469203)


Alignment Details
Target: chr3 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 205
Target Start/End: Complemental strand, 41469203 - 41469002
Alignment:
Q  1 tcatcttcatatcataaacattgtgatttcgaataataattagagtttgtgtacgatggattagcttttctttctttatttcaagtattccattgataga 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  41469203 tcatcttcatatcataaacattgtgatttcgaataataattagagtttgtgtacgatggattagcttttctttctttatttcaagtattccattgataga 41469104  T
Q  101 cccctaaagtattgctaagtttcctttatattagtagcctttacaggtacgcgttttatgatcttgttacttaatggatagtttggagcttgacaagtct 200  Q
    |||||||||||||||||||||||||||||||   |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
T  41469103 cccctaaagtattgctaagtttcctttatat---tagcctttacaggtacgcattttatgatcttgttacttaatggatagtttggagcttgacaagtct 41469007  T
Q  201 aacaa 205  Q
    |||||    
T  41469006 aacaa 41469002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University