View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12023_low_78 (Length: 255)

Name: NF12023_low_78
Description: NF12023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12023_low_78
NF12023_low_78
[»] chr6 (2 HSPs)
chr6 (28-98)||(392510-392576)
chr6 (137-215)||(5948005-5948088)


Alignment Details
Target: chr6 (Bit Score: 50; Significance: 1e-19; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 28 - 98
Target Start/End: Complemental strand, 392576 - 392510
Alignment:
Q  28 tgttatttctttatggttaattaagttgtgttcactttccatcagccttacagaaatgatgttgtagggta 98  Q
    ||||||||||||||||||||    ||||| |||||||||||||||||||||||||||||||||||||||||    
T  392576 tgttatttctttatggttaa----gttgtattcactttccatcagccttacagaaatgatgttgtagggta 392510  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 137 - 215
Target Start/End: Original strand, 5948005 - 5948088
Alignment:
Q  137 tttgttatttttcaggctcaaaagcaaaagtagaat-----gacatacttagatgtgtaaccctagctgttggcatggttaaat 215  Q
    ||||||||||||||||| ||||| ||||| || |||     |||||||||||||| |||||||| |||||||||||||||||||    
T  5948005 tttgttatttttcaggcccaaaaacaaaaatacaataatctgacatacttagatgcgtaaccctggctgttggcatggttaaat 5948088  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University