View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12023_low_111 (Length: 222)

Name: NF12023_low_111
Description: NF12023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12023_low_111
NF12023_low_111
[»] chr8 (2 HSPs)
chr8 (45-203)||(36934819-36934977)
chr8 (1-30)||(36934991-36935020)


Alignment Details
Target: chr8 (Bit Score: 159; Significance: 8e-85; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 45 - 203
Target Start/End: Complemental strand, 36934977 - 36934819
Alignment:
Q  45 ggagacggtggtagttactacgtttggtcgagttctcaaatgccagtgttagcctcaaccaacgttggtgctggtcgccttgtgcttaagcctcaaggct 144  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  36934977 ggagacggtggtagttactacgtttggtcgagttctcaaatgccagtgttagcctcaaccaacgttggtgctggtcgccttgtgcttaagcctcaaggct 36934878  T
Q  145 ttgctcttcctcattatgcagattcctctaaagttgcttatgtcattcaaggtcagtca 203  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  36934877 ttgctcttcctcattatgcagattcctctaaagttgcttatgtcattcaaggtcagtca 36934819  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 30
Target Start/End: Complemental strand, 36935020 - 36934991
Alignment:
Q  1 tgtttgaaggagacggtggtagttttgttc 30  Q
    ||||||||||||||||||||||||||||||    
T  36935020 tgtttgaaggagacggtggtagttttgttc 36934991  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University