View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12023_high_100 (Length: 230)

Name: NF12023_high_100
Description: NF12023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12023_high_100
NF12023_high_100
[»] chr1 (1 HSPs)
chr1 (20-178)||(12570918-12571076)


Alignment Details
Target: chr1 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 20 - 178
Target Start/End: Original strand, 12570918 - 12571076
Alignment:
Q  20 tatccaacgacctagatttagcgcaacgaagggtacaagcgtaatgaatcaaagtagcatgaagtgtgcgagtttgaactttgaagattgataaataaaa 119  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  12570918 tatccaacgacccagatttagcgcaacgaagggtacaagcgtaatgaatcaaagtagcatgaagtgtgcgagtttgaactttgaagattgataaataaaa 12571017  T
Q  120 cagtgtttgggctttatcggagtgaatgagagttacattacagtaacgtgtgtttcgcg 178  Q
    ||||||||||||||||||||||||| ||||||||||||||||  |||||||||||||||    
T  12571018 cagtgtttgggctttatcggagtgagtgagagttacattacacaaacgtgtgtttcgcg 12571076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University