View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12021_low_21 (Length: 213)

Name: NF12021_low_21
Description: NF12021
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12021_low_21
NF12021_low_21
[»] chr6 (1 HSPs)
chr6 (18-193)||(24633875-24634050)
[»] chr7 (1 HSPs)
chr7 (18-184)||(23792525-23792690)
[»] chr5 (1 HSPs)
chr5 (75-172)||(22876321-22876418)
[»] chr8 (1 HSPs)
chr8 (84-183)||(26568367-26568466)
[»] chr1 (1 HSPs)
chr1 (110-190)||(11801109-11801189)


Alignment Details
Target: chr6 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 18 - 193
Target Start/End: Complemental strand, 24634050 - 24633875
Alignment:
Q  18 aaccatggcaagctcgtcctagattgggctatgcagataaactttttgtggttctattcaagttacgcatgccttgattccatgtgtcttgtacgaacga 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||    
T  24634050 aaccatggcaagctcgtcctagattgggctatgcagataaactttttgtggtcctattcaagttacgcatgccttgattcgatgtgtcttgtacgaacga 24633951  T
Q  118 tcaacgtctcttaatgtgcgtctcaatttcacgtgccctgtatggacgaggtgcaacctagttcacacacgacggt 193  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
T  24633950 tcaacgtctcttaatgtgcgtctcaatttcacgtgccctgtatggacgaggtgcaacctagttcacacgcgacggt 24633875  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 67; Significance: 6e-30; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 18 - 184
Target Start/End: Original strand, 23792525 - 23792690
Alignment:
Q  18 aaccatggcaagctcgtcctagattgggctatgcagataaactttttgtggttctattcaagttacgcatgccttgattccatgtgtcttgtacgaacga 117  Q
    ||||||| ||||| ||||| | | ||| |||||||||||||||| ||||| |   |||||| ||||||||||| |||||||| |||||||||||| ||||    
T  23792525 aaccatgccaagcccgtcccaaaatggactatgcagataaacttgttgtgttcacattcaaattacgcatgccctgattccacgtgtcttgtacggacga 23792624  T
Q  118 tcaacgtctcttaatgtgcgtctcaatttcacgtgccctgtatggacgaggtgcaacctagttcaca 184  Q
     |||||||||| || | || |||||||||||||||||| ||||||||||| | ||||||| ||||||    
T  23792625 ccaacgtctctgaaagagcatctcaatttcacgtgccc-gtatggacgagtttcaacctacttcaca 23792690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 75 - 172
Target Start/End: Original strand, 22876321 - 22876418
Alignment:
Q  75 tcaagttacgcatgccttgattccatgtgtcttgtacgaacgatcaacgtctcttaatgtgcgtctcaatttcacgtgccctgtatggacgaggtgca 172  Q
    ||||||||| |||||  |||||||| |||||||||||||| ||||||| ||||| ||   ||||||||| ||||||  || |||| ||||||| ||||    
T  22876321 tcaagttacacatgctctgattccacgtgtcttgtacgaatgatcaacatctctaaaaacgcgtctcaacttcacgcaccttgtacggacgagttgca 22876418  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 84 - 183
Target Start/End: Original strand, 26568367 - 26568466
Alignment:
Q  84 gcatgccttgattccatgtgtcttgtacgaacgatcaacgtctcttaatgtgcgtctcaatttcacgtgccctgtatggacgaggtgcaacctagttcac 183  Q
    |||||| |||||| ||  |||||||||| |||||||||||||| | || | |||||| || ||||| ||  ||||||||||||| |||| ||||| ||||    
T  26568367 gcatgctttgatttcacatgtcttgtacaaacgatcaacgtctttgaaagcgcgtcttaacttcacatgttctgtatggacgagttgcagcctagatcac 26568466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 110 - 190
Target Start/End: Original strand, 11801109 - 11801189
Alignment:
Q  110 acgaacgatcaacgtctcttaatgtgcgtctcaatttcacgtgccctgtatggacgaggtgcaacctagttcacacacgac 190  Q
    ||||| ||||||||||||| || | || |||||| | |||| |||| ||| ||||||| |||| |||||| ||||||||||    
T  11801109 acgaatgatcaacgtctctgaaagcgcatctcaactccacgcgcccagtacggacgagttgcaccctagtccacacacgac 11801189  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University