View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12018_low_44 (Length: 218)

Name: NF12018_low_44
Description: NF12018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12018_low_44
NF12018_low_44
[»] chr7 (1 HSPs)
chr7 (89-212)||(3872054-3872177)


Alignment Details
Target: chr7 (Bit Score: 99; Significance: 5e-49; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 89 - 212
Target Start/End: Complemental strand, 3872177 - 3872054
Alignment:
Q  89 gagagaatacggaaaatttctctataaaagtgtggagaatgaagagatattttannnnnnngtcgctaattaaatttatattttcaagtcatgtttagtt 188  Q
    |||||||||||||||||||||||||||||||||||| |||||||||||||||||       |||||||||||||||||||||||||||||||||||||||    
T  3872177 gagagaatacggaaaatttctctataaaagtgtggataatgaagagatattttatttttttgtcgctaattaaatttatattttcaagtcatgtttagtt 3872078  T
Q  189 taatgtctctaatggatcctttgc 212  Q
    ||||||||||||||||||||||||    
T  3872077 taatgtctctaatggatcctttgc 3872054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University