View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1200_low_39 (Length: 218)

Name: NF1200_low_39
Description: NF1200
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1200_low_39
NF1200_low_39
[»] chr3 (1 HSPs)
chr3 (13-203)||(42442951-42443141)
[»] chr5 (1 HSPs)
chr5 (36-120)||(17047406-17047489)


Alignment Details
Target: chr3 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 13 - 203
Target Start/End: Original strand, 42442951 - 42443141
Alignment:
Q  13 gagatgaatgtgtggcgggatggaacatgagtttggttggtgggtaagggtgatcgaaggagagtgaaggttgaggtttgagtgagagggtatcggggtt 112  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  42442951 gagaagaatgtgtggcgggatggaacatgagtttggttggtgggtaagggtgatcgaaggagagtgaaggttgaggtttgagtgagagggtatcggggtt 42443050  T
Q  113 gaaattgaggatatcgatgcggtttgtgtattcttcgatgaagcttccgacggcgatacgttgttgtggggaatttgtgttgggagagatg 203  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  42443051 gaaattgagaatatcgatgcggtttgtgtattcttcgatgaagcttccgacggcgatacgttgttgtggggaatttgtgttgggagagatg 42443141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 61; Significance: 2e-26; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 36 - 120
Target Start/End: Original strand, 17047406 - 17047489
Alignment:
Q  36 aacatgagtttggttggtgggtaagggtgatcgaaggagagtgaaggttgaggtttgagtgagagggtatcggggttgaaattga 120  Q
    |||||||||||||| ||||||||||| |||||||||||||||||||| |||||||||||||||||||||||  ||||||||||||    
T  17047406 aacatgagtttggtgggtgggtaaggatgatcgaaggagagtgaaggatgaggtttgagtgagagggtatc-tggttgaaattga 17047489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University