View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1199_low_96 (Length: 397)

Name: NF1199_low_96
Description: NF1199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1199_low_96
NF1199_low_96
[»] chr4 (2 HSPs)
chr4 (177-298)||(962125-962246)
chr4 (84-137)||(962284-962337)


Alignment Details
Target: chr4 (Bit Score: 114; Significance: 1e-57; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 177 - 298
Target Start/End: Complemental strand, 962246 - 962125
Alignment:
Q  177 cttaccttggattatgttttttctattacatagtaatgttacatcatgttcatgctcgtgtctttcgcaatagtaatgcgcattttctttttatcttaac 276  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||    
T  962246 cttaccttggattatgttttttctattacatagtaatgttacatcatgctcatgctcgtgtcttttgcaatagtaatgcgcattttctttttatcttaac 962147  T
Q  277 cctccgattcgttagagaaaaa 298  Q
    ||||||||||||||||||||||    
T  962146 cctccgattcgttagagaaaaa 962125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 84 - 137
Target Start/End: Complemental strand, 962337 - 962284
Alignment:
Q  84 caagaatatgaagacgtggcacatccctaatgtttagtgcacatttttcttttg 137  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  962337 caagaatatgaagacgtggcacatccctaatgtttagtgcacatttttcttttg 962284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University