View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11992_low_19 (Length: 357)

Name: NF11992_low_19
Description: NF11992
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11992_low_19
NF11992_low_19
[»] chr6 (1 HSPs)
chr6 (26-195)||(31644816-31644985)


Alignment Details
Target: chr6 (Bit Score: 106; Significance: 5e-53; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 106; E-Value: 5e-53
Query Start/End: Original strand, 26 - 195
Target Start/End: Complemental strand, 31644985 - 31644816
Alignment:
Q  26 atttatgtatttaagatttttgtggctagttcaatccttcttttttatgcaagcaaaataaagacattttattaattatattgtcataaatgcattcaag 125  Q
    |||||||||||||||||||||   |||||||  |||||||||||||||| || ||||||||||| |||| ||||||||||||||||||||||||||||||    
T  31644985 atttatgtatttaagatttttccagctagttttatccttcttttttatgtaaacaaaataaagaaatttcattaattatattgtcataaatgcattcaag 31644886  T
Q  126 aatataattggaaaccctacaaggagcataagataacgctgctcttgcaagagtatgagttctaccattt 195  Q
    ||| ||||||||||||||||||||||||||||||||| | | |||||||||||||  |||| ||||||||    
T  31644885 aatgtaattggaaaccctacaaggagcataagataacaccgttcttgcaagagtacaagttttaccattt 31644816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University