View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11991_low_6 (Length: 242)

Name: NF11991_low_6
Description: NF11991
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11991_low_6
NF11991_low_6
[»] chr5 (1 HSPs)
chr5 (1-116)||(19441922-19442037)


Alignment Details
Target: chr5 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 1 - 116
Target Start/End: Complemental strand, 19442037 - 19441922
Alignment:
Q  1 taatctcagatgatttcgtatttgccaagaaacatctttccatgtcaaagaaacgtcagcacctcatcacagccacatggatcaagccaacaaagttaat 100  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
T  19442037 taatctcagatgatttcgtattcgccaagaaacatctttccatgtcaaagaaacgtcagcacctcatcacagccacatggatcaaaccaacaaagttaat 19441938  T
Q  101 tttaatgtcttatgaa 116  Q
    ||||||||||||||||    
T  19441937 tttaatgtcttatgaa 19441922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University