View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11982A_low_505 (Length: 220)

Name: NF11982A_low_505
Description: NF11982A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11982A_low_505
NF11982A_low_505
[»] chr8 (1 HSPs)
chr8 (20-180)||(41223051-41223205)


Alignment Details
Target: chr8 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 20 - 180
Target Start/End: Complemental strand, 41223205 - 41223051
Alignment:
Q  20 aaaatactcagagggagagatttgatccctttgtgatcctatccggttcgagtaattagtctctgcagtcgtgcgcagaggcaggatattgattcacatt 119  Q
    |||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||| |||| ||||| |||||||||||    
T  41223205 aaaatactcagagggagagatttgatcc-tttgtgatcctatccggttcgaggaattagtctctgcagtcgtgcgcaaaggctggatactgattcacatt 41223107  T
Q  120 aaaaaggagttcaattcaattcaatagaatttttcgattctatgtcttcggaactatattc 180  Q
    ||||||||||||||||     ||||||||||||| ||||||||||||||||||||||||||    
T  41223106 aaaaaggagttcaatt-----caatagaattttttgattctatgtcttcggaactatattc 41223051  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University