View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11982A_low_492 (Length: 225)

Name: NF11982A_low_492
Description: NF11982A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11982A_low_492
NF11982A_low_492
[»] chr7 (2 HSPs)
chr7 (18-225)||(38883894-38884101)
chr7 (18-221)||(38893086-38893289)
[»] chr3 (1 HSPs)
chr3 (103-216)||(37315993-37316106)
[»] chr1 (1 HSPs)
chr1 (130-224)||(33115133-33115227)


Alignment Details
Target: chr7 (Bit Score: 208; Significance: 1e-114; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 18 - 225
Target Start/End: Original strand, 38883894 - 38884101
Alignment:
Q  18 ctatgatctgttctgtgtatcccttgttacaaagttgctcggtcgcatatactaccacgttgatggtgctgcgaagcccggtacattgcctcccaatgta 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  38883894 ctatgatctgttctgtgtatcccttgttacaaagttgctcggtcgcatatactaccacgttgatggtgctgcgaagcccggtacattgcctcccaatgta 38883993  T
Q  118 tcagctgctgtgaatggtgtagctttctgtggaacactttcagggcaacttttctttggctggcttggtgataagatgggcaggaaaaaagtctatggta 217  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  38883994 tcagctgctgtgaatggtgtagctttctgtggaacactttcagggcaacttttctttggctggcttggtgataagatgggcaggaaaaaagtctatggta 38884093  T
Q  218 tgaccctc 225  Q
    ||||||||    
T  38884094 tgaccctc 38884101  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 18 - 221
Target Start/End: Original strand, 38893086 - 38893289
Alignment:
Q  18 ctatgatctgttctgtgtatcccttgttacaaagttgctcggtcgcatatactaccacgttgatggtgctgcgaagcccggtacattgcctcccaatgta 117  Q
    |||||||||||||||  ||||||||||||| |||||||| || |||||||| ||||| ||||||||||| | |||||||||||||||||| |||||||||    
T  38893086 ctatgatctgttctgcatatcccttgttaccaagttgctgggacgcatatattaccatgttgatggtgccgggaagcccggtacattgccacccaatgta 38893185  T
Q  118 tcagctgctgtgaatggtgtagctttctgtggaacactttcagggcaacttttctttggctggcttggtgataagatgggcaggaaaaaagtctatggta 217  Q
    |||||||| || ||||| || ||||||||||| |||||| ||||||| ||||||||||||||||||||||||||| |||| ||||| ||||| |||||||    
T  38893186 tcagctgcggttaatggggttgctttctgtggtacacttacagggcagcttttctttggctggcttggtgataagttgggtaggaagaaagtgtatggta 38893285  T
Q  218 tgac 221  Q
    ||||    
T  38893286 tgac 38893289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 103 - 216
Target Start/End: Complemental strand, 37316106 - 37315993
Alignment:
Q  103 ttgcctcccaatgtatcagctgctgtgaatggtgtagctttctgtggaacactttcagggcaacttttctttggctggcttggtgataagatgggcagga 202  Q
    |||||||| ||||||||||| || || |||||||| ||| ||||||| || ||  |||| |||||||||||||| |||||||| || || ||||| || |    
T  37316106 ttgcctccaaatgtatcagcagcagtaaatggtgttgctctctgtggcactctagcaggccaacttttctttggttggcttggggacaaaatgggaagaa 37316007  T
Q  203 aaaaagtctatggt 216  Q
    ||||||| ||||||    
T  37316006 aaaaagtttatggt 37315993  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 130 - 224
Target Start/End: Original strand, 33115133 - 33115227
Alignment:
Q  130 aatggtgtagctttctgtggaacactttcagggcaacttttctttggctggcttggtgataagatgggcaggaaaaaagtctatggtatgaccct 224  Q
    |||||||| |||||| ||||| ||||  |||| |||||||||||||| ||||||||||| || ||||| || |||  ||| ||||| ||||||||    
T  33115133 aatggtgttgctttcagtggagcactggcaggacaacttttctttggttggcttggtgacaaaatgggaagaaaacgagtttatggaatgaccct 33115227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University