View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11982A_low_288 (Length: 251)

Name: NF11982A_low_288
Description: NF11982A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11982A_low_288
NF11982A_low_288
[»] chr2 (1 HSPs)
chr2 (1-239)||(3884226-3884464)
[»] chr4 (2 HSPs)
chr4 (67-119)||(35240794-35240846)
chr4 (67-105)||(35237790-35237828)


Alignment Details
Target: chr2 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 3884226 - 3884464
Alignment:
Q  1 tttgtttcagtttagggacatgataaagatgttctttccagttgttgggatagaacgggaaagtatattgcctctgtcagtgaagattgtgcacgagtct 100  Q
    ||||||||  |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  3884226 tttgtttccttttagggacatgataaagatgttctttccatttgttgggatagaacgggaaagtatattgcctctgtcagtgaagattgtgcacgagtct 3884325  T
Q  101 ggtcggacggagaatgcatcggcgagttgcattcaaacgggaacaagtttcaatcgtgcatatttcatccgggatattgtaacctcttagttattggtgg 200  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  3884326 ggtcgaacggagaatgcatcggcgagttgcattcaaacgggaacaagtttcaatcgtgcatatttcatccgggatattgtaacctcttagttattggtgg 3884425  T
Q  201 ctatcaggtaagcccttcttccatcatgtgattgatatt 239  Q
    |||||||||||||||||||||||||||||||||||||||    
T  3884426 ctatcaggtaagcccttcttccatcatgtgattgatatt 3884464  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 67 - 119
Target Start/End: Complemental strand, 35240846 - 35240794
Alignment:
Q  67 attgcctctgtcagtgaagattgtgcacgagtctggtcggacggagaatgcat 119  Q
    |||||||||||||||||||||  || ||| ||||||||||||||| |||||||    
T  35240846 attgcctctgtcagtgaagatgatgtacgtgtctggtcggacggacaatgcat 35240794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 67 - 105
Target Start/End: Complemental strand, 35237828 - 35237790
Alignment:
Q  67 attgcctctgtcagtgaagattgtgcacgagtctggtcg 105  Q
    ||||||||||||| ||||||||||||||| |||||||||    
T  35237828 attgcctctgtcactgaagattgtgcacgtgtctggtcg 35237790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University