View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11980_high_72 (Length: 272)

Name: NF11980_high_72
Description: NF11980
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11980_high_72
NF11980_high_72
[»] chr6 (1 HSPs)
chr6 (71-261)||(32861069-32861259)


Alignment Details
Target: chr6 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 71 - 261
Target Start/End: Original strand, 32861069 - 32861259
Alignment:
Q  71 tgggttttggagtaattttagaaatgttttgttggggaattttatgatgggttctaagttggatgatgagtatagacaagctgttgttagggttgatgaa 170  Q
    |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  32861069 tgggttttggagtaattttagaaatgttttgttgggaaattttatgatgggttctaagttggatgatgagtatagacaagctgttgttagggttgatgaa 32861168  T
Q  171 gttctatctaaggtgagttcttgtttttgatgttttatcattttttaatctgtttggataattaattgtttcatatagcataagcacttat 261  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  32861169 gttctatctaaggtgagttcttgtttttgatgttttatcattttttaatctgtttggataattaattgtttcatatagcataagcacttat 32861259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University