View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11976_high_19 (Length: 296)

Name: NF11976_high_19
Description: NF11976
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11976_high_19
NF11976_high_19
[»] chr7 (1 HSPs)
chr7 (124-293)||(28397671-28397840)


Alignment Details
Target: chr7 (Bit Score: 166; Significance: 7e-89; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 166; E-Value: 7e-89
Query Start/End: Original strand, 124 - 293
Target Start/End: Original strand, 28397671 - 28397840
Alignment:
Q  124 atgagtatgatttccgatcatggctcaagattcaactctcctttttcttgttttgatcataaatggcttgaatgtacctttgcattgttggtctcaactc 223  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  28397671 atgagtatgatttccgatcatggctcaagattcaactctcctttttcttgttttgatcataaatggcttgaatgtacctttgcattgttggtctcaactc 28397770  T
Q  224 cactgcgttatttatttatgttgctgtttgtttttagagtaaagttcctagctttctagcgcactttcaa 293  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
T  28397771 cactgcgttatttatttatgttgctgtttgtttttagagtaaagttcctagctttatagcgcactttcaa 28397840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University