View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11971_low_21 (Length: 302)

Name: NF11971_low_21
Description: NF11971
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11971_low_21
NF11971_low_21
[»] chr8 (3 HSPs)
chr8 (196-287)||(13467871-13467962)
chr8 (1-151)||(13471842-13471991)
chr8 (249-286)||(13472021-13472058)


Alignment Details
Target: chr8 (Bit Score: 80; Significance: 2e-37; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 196 - 287
Target Start/End: Original strand, 13467871 - 13467962
Alignment:
Q  196 atccaaaacaacaaaatccaagtagtcacttaacctatgttcatgtatgtcccttgacaattgctattttcaaaccctatcagtcagttcat 287  Q
    ||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
T  13467871 atccaaaacaacaaaatccaactagtgacttaacctatgttcatgtatgtcccttgacaattgctattttcaaaccatatcagtcagttcat 13467962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 1 - 151
Target Start/End: Original strand, 13471842 - 13471991
Alignment:
Q  1 taaattcaagtattggctaactaacaaatatgcaattcaatgttttaaaagggatcgaaacaaaataaatctttgatgatcacagagttcatagagcaca 100  Q
    |||||||| || ||||||||||||||||||||||||||||| | ||||||| |||| || |||||| |||| ||||| ||||||||| ||||||||||||    
T  13471842 taaattcatgtcttggctaactaacaaatatgcaattcaatttcttaaaagtgatcaaagcaaaattaatcattgataatcacagagctcatagagcaca 13471941  T
Q  101 atatgtcactcaccaaactagttgcaaaacctatgaacatatacacttcaa 151  Q
    |||| |  || ||||||||||||||||||||| ||| || ||| |||||||    
T  13471942 atatat-gcttaccaaactagttgcaaaacctgtgagcagatatacttcaa 13471991  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 249 - 286
Target Start/End: Original strand, 13472021 - 13472058
Alignment:
Q  249 ttgacaattgctattttcaaaccctatcagtcagttca 286  Q
    ||||||||||||||||||||| ||||||||||||||||    
T  13472021 ttgacaattgctattttcaaatcctatcagtcagttca 13472058  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University