View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1196_low_14 (Length: 299)

Name: NF1196_low_14
Description: NF1196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1196_low_14
NF1196_low_14
[»] chr1 (1 HSPs)
chr1 (91-269)||(22101686-22101864)


Alignment Details
Target: chr1 (Bit Score: 147; Significance: 2e-77; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 91 - 269
Target Start/End: Original strand, 22101686 - 22101864
Alignment:
Q  91 ctgttgttactcgagggtgtactgttgaaatcatccctcgatctgggttctacgtgtgtttggagcttgtttcctctgagtcattccgtgggattggcta 190  Q
    ||||||| ||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||    
T  22101686 ctgttgtgacttgagggtgtactgttgaaatcatccctcgatctgggttctacgcgtgtttggagcttgtttcctctgagtcattccgtgtgattggcta 22101785  T
Q  191 cagggctacaaatggcatgtggaagcttattgtttcgttgctgcgcaatgagctgtaggtgtggggtttcatatctgtg 269  Q
     ||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
T  22101786 tagggctataaatggcatgtggaggcttattgtttcgttgctgcgcaatgagctgtaggtgtggggtttcgtatctgtg 22101864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University