View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11957_low_1 (Length: 598)

Name: NF11957_low_1
Description: NF11957
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11957_low_1
NF11957_low_1
[»] chr5 (3 HSPs)
chr5 (254-448)||(2245084-2245279)
chr5 (491-598)||(2245314-2245420)
chr5 (187-215)||(2245013-2245041)


Alignment Details
Target: chr5 (Bit Score: 176; Significance: 2e-94; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 176; E-Value: 2e-94
Query Start/End: Original strand, 254 - 448
Target Start/End: Original strand, 2245084 - 2245279
Alignment:
Q  254 attaaccgtctcgtggtcgaggaccctatagtcatttaagtcaatccacaaagacaatcgagacgttttcccagttgtgcgtgtgaatagggagtgggat 353  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  2245084 attaaccgtctcgtggtcgaggaccctttagtcatttaagtcaatccacaaagacaatcgagacgttttcccagttgtgcgtgtgaatagggagtgggat 2245183  T
Q  354 tcgttgtctgataagcaactatgctcttc-ttgttgctaactataaatgcaccccacctatcctatcacttgcagcaacccatacatacacacatt 448  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||    
T  2245184 tcgttgtctgataagcaactatgctcttctttgttgctaactataaatgcaccccacctatcctatcacttgctgcaacccatacattcacacatt 2245279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 491 - 598
Target Start/End: Original strand, 2245314 - 2245420
Alignment:
Q  491 aaccttcactaactcataaagaaggcaccaannnnnnnnaagtaaccttcttcctaataccatagtcatggagggaatgcaaaacagagatattggatca 590  Q
    ||||||||||||||||||||||||||||||         | ||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||    
T  2245314 aaccttcactaactcataaagaaggcaccactttttttca-gtaaccttcttcctaataccatagtcatggatggaattcaaaacagagatattggatca 2245412  T
Q  591 tgtttatc 598  Q
    ||||||||    
T  2245413 tgtttatc 2245420  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 187 - 215
Target Start/End: Original strand, 2245013 - 2245041
Alignment:
Q  187 tgtttaaccgaacaaattaaacaagttac 215  Q
    |||||||||||||||||||||||||||||    
T  2245013 tgtttaaccgaacaaattaaacaagttac 2245041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University