View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11955_high_8 (Length: 502)

Name: NF11955_high_8
Description: NF11955
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11955_high_8
NF11955_high_8
[»] scaffold0245 (1 HSPs)
scaffold0245 (219-273)||(18894-18948)
[»] chr1 (1 HSPs)
chr1 (219-273)||(1292487-1292541)


Alignment Details
Target: scaffold0245 (Bit Score: 43; Significance: 0.000000000000003; HSPs: 1)
Name: scaffold0245
Description:

Target: scaffold0245; HSP #1
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 219 - 273
Target Start/End: Original strand, 18894 - 18948
Alignment:
Q  219 ggtgattgtcaacgaggggagtggaagtttttcaggtaagccatacttccaaggt 273  Q
    |||||||||| ||| | ||||||||||||||||||||||||||||||||||||||    
T  18894 ggtgattgtccacgtgaggagtggaagtttttcaggtaagccatacttccaaggt 18948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 43; Significance: 0.000000000000003; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 219 - 273
Target Start/End: Original strand, 1292487 - 1292541
Alignment:
Q  219 ggtgattgtcaacgaggggagtggaagtttttcaggtaagccatacttccaaggt 273  Q
    |||||||||| ||| | ||||||||||||||||||||||||||||||||||||||    
T  1292487 ggtgattgtccacgtgaggagtggaagtttttcaggtaagccatacttccaaggt 1292541  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University