View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11942_high_25 (Length: 374)

Name: NF11942_high_25
Description: NF11942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11942_high_25
NF11942_high_25
[»] chr4 (3 HSPs)
chr4 (210-337)||(35765787-35765914)
chr4 (216-262)||(13217018-13217064)
chr4 (213-262)||(27001072-27001121)
[»] chr8 (2 HSPs)
chr8 (1-118)||(4853801-4853918)
chr8 (220-258)||(14976547-14976585)
[»] chr6 (1 HSPs)
chr6 (216-262)||(6261056-6261102)
[»] chr1 (1 HSPs)
chr1 (220-262)||(13693848-13693890)
[»] chr3 (4 HSPs)
chr3 (215-262)||(17372813-17372860)
chr3 (216-258)||(43430279-43430321)
chr3 (230-263)||(39721811-39721844)
chr3 (216-264)||(30075438-30075486)
[»] chr2 (1 HSPs)
chr2 (212-262)||(3548107-3548157)
[»] chr5 (1 HSPs)
chr5 (217-262)||(34403842-34403887)


Alignment Details
Target: chr4 (Bit Score: 124; Significance: 1e-63; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 124; E-Value: 1e-63
Query Start/End: Original strand, 210 - 337
Target Start/End: Original strand, 35765787 - 35765914
Alignment:
Q  210 tattggactggtgtggcacctgccacaccatgcctagttcaggtccgcccctgctgatgatgctcttcatgctactcagaacgaactttctgaatttggt 309  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  35765787 tattggactggtgtggcacctgccacaccatgcctagttcaggtccgcccctgctgatgatgctcttcatgctactcagaacgaactttctgaatttggt 35765886  T
Q  310 tgtatcatgactttctgtcggtccctat 337  Q
    ||||||||| ||||||||||||||||||    
T  35765887 tgtatcatgtctttctgtcggtccctat 35765914  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 216 - 262
Target Start/End: Original strand, 13217018 - 13217064
Alignment:
Q  216 actggtgtggcacctgccacaccatgcctagttcaggtccgcccctg 262  Q
    ||||||||||||||||||||||||| ||| |||||||||||||||||    
T  13217018 actggtgtggcacctgccacaccataccttgttcaggtccgcccctg 13217064  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 213 - 262
Target Start/End: Complemental strand, 27001121 - 27001072
Alignment:
Q  213 tggactggtgtggcacctgccacaccatgcctagttcaggtccgcccctg 262  Q
    |||||||||||||||| |||||||||  ||||||| ||||||||||||||    
T  27001121 tggactggtgtggcacttgccacaccgggcctagtccaggtccgcccctg 27001072  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 102; Significance: 1e-50; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 1 - 118
Target Start/End: Complemental strand, 4853918 - 4853801
Alignment:
Q  1 gaaaaatgtccttacaaataattcatcaacgagacacttatatttgctgtaaacatttcaatttcttacttctttcattattataatgtataagtctagc 100  Q
    ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||    
T  4853918 gaaaaatgtccttccaaataattcatcaacgagacacttatatttgctgtaaacatttcaatttcttacttcttgcattattatagtgtataagtctagc 4853819  T
Q  101 ctttaaactactttatat 118  Q
    | ||||||||||||||||    
T  4853818 cgttaaactactttatat 4853801  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 220 - 258
Target Start/End: Complemental strand, 14976585 - 14976547
Alignment:
Q  220 gtgtggcacctgccacaccatgcctagttcaggtccgcc 258  Q
    ||||||||| ||||||||||||||| |||||||||||||    
T  14976585 gtgtggcacttgccacaccatgccttgttcaggtccgcc 14976547  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 216 - 262
Target Start/End: Complemental strand, 6261102 - 6261056
Alignment:
Q  216 actggtgtggcacctgccacaccatgcctagttcaggtccgcccctg 262  Q
    ||||||||| ||||||||||||||||||| |||||||||||| ||||    
T  6261102 actggtgtgacacctgccacaccatgccttgttcaggtccgctcctg 6261056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 220 - 262
Target Start/End: Complemental strand, 13693890 - 13693848
Alignment:
Q  220 gtgtggcacctgccacaccatgcctagttcaggtccgcccctg 262  Q
    |||||||||||||||||| |||||| |||||||||||||||||    
T  13693890 gtgtggcacctgccacactatgccttgttcaggtccgcccctg 13693848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 32; Significance: 0.000000008; HSPs: 4)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 215 - 262
Target Start/End: Original strand, 17372813 - 17372860
Alignment:
Q  215 gactggtgtggcacctgccacaccatgcctagttcaggtccgcccctg 262  Q
    |||||||||||||| |||||||||  ||||||| ||||||||||||||    
T  17372813 gactggtgtggcacttgccacaccgggcctagtccaggtccgcccctg 17372860  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 216 - 258
Target Start/End: Original strand, 43430279 - 43430321
Alignment:
Q  216 actggtgtggcacctgccacaccatgcctagttcaggtccgcc 258  Q
    ||||||||||||| |||||||| |||||| |||||||||||||    
T  43430279 actggtgtggcacttgccacacgatgccttgttcaggtccgcc 43430321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 230 - 263
Target Start/End: Complemental strand, 39721844 - 39721811
Alignment:
Q  230 tgccacaccatgcctagttcaggtccgcccctgc 263  Q
    ||||||||||||||| ||||||||||||||||||    
T  39721844 tgccacaccatgccttgttcaggtccgcccctgc 39721811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 216 - 264
Target Start/End: Complemental strand, 30075486 - 30075438
Alignment:
Q  216 actggtgtggcacctgccacaccatgcctagttcaggtccgcccctgct 264  Q
    ||||||||||||| ||||||||||||||| ||||| ||  |||||||||    
T  30075486 actggtgtggcacttgccacaccatgccttgttcaagtttgcccctgct 30075438  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 212 - 262
Target Start/End: Complemental strand, 3548157 - 3548107
Alignment:
Q  212 ttggactggtgtggcacctgccacaccatgcctagttcaggtccgcccctg 262  Q
    ||||||||||||||||| ||||| |||  ||||||| ||||||||||||||    
T  3548157 ttggactggtgtggcacttgccataccgagcctagtccaggtccgcccctg 3548107  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 217 - 262
Target Start/End: Complemental strand, 34403887 - 34403842
Alignment:
Q  217 ctggtgtggcacctgccacaccatgcctagttcaggtccgcccctg 262  Q
    |||||||||||| ||||||||   ||||||||||||||||||||||    
T  34403887 ctggtgtggcacttgccacactgggcctagttcaggtccgcccctg 34403842  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University