View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11939_high_15 (Length: 222)

Name: NF11939_high_15
Description: NF11939
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11939_high_15
NF11939_high_15
[»] chr2 (4 HSPs)
chr2 (22-208)||(9258371-9258557)
chr2 (23-208)||(9268379-9268564)
chr2 (72-202)||(9250306-9250436)
chr2 (70-202)||(9237782-9237914)


Alignment Details
Target: chr2 (Bit Score: 183; Significance: 4e-99; HSPs: 4)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 22 - 208
Target Start/End: Complemental strand, 9258557 - 9258371
Alignment:
Q  22 gtatgcaaatgcgtgtgttgctgattccgtgattaaggattttgtgagaatttgtttagatttgaaggacaaaaagttgcagggtgtttaccttgaagtg 121  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  9258557 gtatgcaaatgcgtgtgttgctgattccgtgattaaggattttgtgagaatttgtttagatttgaaggacaaaaagttgcagggtgtttaccttgaagtg 9258458  T
Q  122 tcattggagttttgtgaattgcttagaagggcacggtgtaagtacgatgatcctctgtatgttttttgccgggatagtttttcatct 208  Q
    |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
T  9258457 tcattggagttttgtgaattgcttagaagggcacggtgtaagtatgatgatcctctgtatgttttttgccgggatagtttttcatct 9258371  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 23 - 208
Target Start/End: Complemental strand, 9268564 - 9268379
Alignment:
Q  23 tatgcaaatgcgtgtgttgctgattccgtgattaaggattttgtgagaatttgtttagatttgaaggacaaaaagttgcagggtgtttaccttgaagtgt 122  Q
    |||||||||| | || ||||| |||| ||||||||||||||||||| |||||| ||| ||| ||||||||||||||||||||||||||||||||||||||    
T  9268564 tatgcaaatgggcgtattgcttattctgtgattaaggattttgtgaaaatttgcttaaattcgaaggacaaaaagttgcagggtgtttaccttgaagtgt 9268465  T
Q  123 cattggagttttgtgaattgcttagaagggcacggtgtaagtacgatgatcctctgtatgttttttgccgggatagtttttcatct 208  Q
     |||||||||||||||||||||||||||| || ||||||||| |||||||| |||||||||||||||||||||||||||| |||||    
T  9268464 tattggagttttgtgaattgcttagaaggacagggtgtaagtccgatgatcgtctgtatgttttttgccgggatagttttgcatct 9268379  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 72 - 202
Target Start/End: Complemental strand, 9250436 - 9250306
Alignment:
Q  72 tttgtttagatttgaaggacaaaaagttgcagggtgtttaccttgaagtgtcattggagttttgtgaattgcttagaagggcacggtgtaagtacgatga 171  Q
    |||||||||||||||||  ||||| ||||||| ||| |||||| |||||||  |||||||||||||||||||||||| ||| | |||||||||  ||| |    
T  9250436 tttgtttagatttgaagtgcaaaacgttgcagagtgcttacctagaagtgttgttggagttttgtgaattgcttagaggggtagggtgtaagtgtgatca 9250337  T
Q  172 tcctctgtatgttttttgccgggatagtttt 202  Q
    |||| ||||||||| ||| |||||| |||||    
T  9250336 tcctttgtatgtttgttgtcgggatggtttt 9250306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 70 - 202
Target Start/End: Complemental strand, 9237914 - 9237782
Alignment:
Q  70 aatttgtttagatttgaaggacaaaaagttgcagggtgtttaccttgaagtgtcattggagttttgtgaattgcttagaagggcacggtgtaagtacgat 169  Q
    |||||||||||||||||||  |||||||||||||||| | ||||||||| | |  ||||| |||||||||||||||||| ||| | | | || ||  |||    
T  9237914 aatttgtttagatttgaagtgcaaaaagttgcagggtttctaccttgaaattttgttggatttttgtgaattgcttagaggggtaggttttacgtgtgat 9237815  T
Q  170 gatcctctgtatgttttttgccgggatagtttt 202  Q
    || ||| ||||||||| ||| |||||| |||||    
T  9237814 gagcctttgtatgtttcttgtcgggatggtttt 9237782  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University